Help icon

Detection Image Detection method details

Name:

QT-TAX-ZM-001

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize alcoholdeydrogenase 1 (adh1) gene.

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 1

Comment:

Target is the alcohol deydrogenase 1 (adh1) gene from maize (Zea mays). This assay is recommended for GMO quantitative analysis.

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

taxon-specific

Target Species name:

Zea mays
  • Oligonucleotides:

  • Forward Primer

  • Name:

    ADH-FF3
  • Sequence:

    CGTCGTTTCCCATCTCTTCCTCC
  • Size:

    23
  • Reverse Primer

  • Name:

    ADH-RR4
  • Sequence:

    CCACTCCGAGACCCTCAGTC
  • Size:

    20
  • Probe

  • Name:

    ADH1-MDO
  • Sequence:

    AATCAGGGCTCATTTTCTCGCTCCTCA
  • Size:

    27
  • Amplicon:

  • Sequence:

    cgtcgtttcccatctcttcctccnnnnnnnnnnnnnnnnnnnnaatcagggctcattttctcgctcctcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngactgagggtctcggagtgg
  • Size:

    135

Documents

Citation Type Local copy
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document
EU-RL GMFF GMOMETHODS database; QT-TAX-ZM-001Link to the document url. EU reference method protocol