Help icon

Detection Image Detection method details

Name:

QT-TAX-SPS primer f/SPS primer r

Description:

Quantitative real-time PCR (TaqMan) method for detection of the rice sucrose phosphate synthase (SPS) gene (ISO21570 Amd1)

Comment:

Target is the endogenous sucrose phosphate synthase (SPS) gene from Oryza sativa

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

taxon-specific

Target Species name:

Oryza sativa
  • Oligonucleotides:

  • Forward Primer

  • Name:

    SPS primer f
  • Sequence:

    TTGCGCCTGAACGGATAT
  • Size:

    18
  • Reverse Primer

  • Name:

    SPS primer r
  • Sequence:

    CGGTTGATCTTTTCGGGATG
  • Size:

    20
  • Probe

  • Name:

    SPS probe
  • Sequence:

    TCCGAGCCGTCCGTGCGTC
  • Size:

    19
  • Amplicon:

  • Sequence:

    ttgcgcctgaacggatatctttcagtttgtaaccaccggatgacgcacggacggctcggatcatcccgaaaagatcaaccg
  • Size:

    81

Documents

Citation Type Local copy
Yang L., Yang Y., Jin W., Zhang X., Li X., Wu Y., Li J., Li L. (2018) Development and interlaboratories validation of event-specific quantitative real-time PCR method for genetically modified rice G6H1 event. Journal of Agricultural and Food Chemistry, 66(30),8179-8186Link to the document url. peer-reviewed article 31-10-2018
Ding J, Jia, J, Yang L, Wen H, Zhang C, Liu W, Zhang D (2004) Validation of a rice specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes. J Agric Food Chem 5Link to the document url.