Help icon

Detection Image Detection method details

Name:

QT-TAX-OS-002

Description:

Quantitative real-time PCR (TaqMan) method for detection of rice phospholipase D alpha 2 gene (EU-RL GMFF GMOMETHODS database as of April 19, 2016)

Comment:

Target is the phospholipase D alpha 2 (PLD) gene from rice.

Amplicon sequence based on GenBank AP014962 (Oryza sativa Japonica, cultivar: Nipponbare) and GenBank CP012614.1 (Oryza sativa Indica cultivar: RP Bio-226)

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Oryza sativa
  • Oligonucleotides:

  • Forward Primer

  • Name:

    PLD-GR For
  • Sequence:

    GGCAAGAACAACACCATTGACA
  • Size:

    22
  • Reverse Primer

  • Name:

    PLD-GR Rev
  • Sequence:

    CGGCTTTCCATGCAAATGA
  • Size:

    19
  • Probe

  • Name:

    PLD-GR Probe
  • Sequence:

    ATTCGCCGCGCCAAGAACTTCA
  • Size:

    22
  • Amplicon:

  • Sequence:

    GGCAAGAACAACACCATTGACAGGAGCATCCAAGATGCATACATCCACGCAATTCGCCGCGCCAAGAACTTCATCTACATCGAGAATCAGTACTTCCTTGGCAGCTCATTTGCATGGAAAGCCG
  • Size:

    124

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-TAX-OS-002Link to the document url. EU reference method protocol 16-01-2020