Help icon

Detection Image Detection method details

Name:

QT-TAX-FatA primer1/FatA primer2

Description:

Quantitative real-time PCR (TaqMan) method for the detection of oilseed rape (Monsanto, 2004, A recommended procedure for real-time quantitative TaqMan PCR for Roundup Ready canola RT73).

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 2

Comment:

Target is the endogenous acyl-acyl carrier protein thioesterase (FatA) gene of Brassica napus.

This assay is NOT recommended for GMO quantitative analysis because of a secondary target with mismatches in the primers and probe annealing region.

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

taxon-specific

Target Species name:

Brassica napus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    FatA primer1
  • Sequence:

    GGTCTCTCAGCAAGTGGGTGAT
  • Size:

    22
  • Reverse Primer

  • Name:

    FatA primer2
  • Sequence:

    TCGTCCCGAACTTCATCTGTAA
  • Size:

    22
  • Probe

  • Name:

    FatA probe
  • Sequence:

    ATGAACCAAGACACAAGGCGGCTTCA
  • Size:

    26
  • Amplicon:

  • Sequence:

    GGTCTCTCAGCAAGTGGGTGATGATGAACCAAGACACAAGGCGGCTTCAAAGAGTTACAGATGAAGTTCGGGACGA
  • Size:

    76

Documents

Citation Type Local copy
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018