Help icon

Detection Image Detection method details

Name:

QT-TAX-BN-003

Description:

Quantitative real-time PCR (TaqMan) method for detection of oilseed rape cruciferin A gene (Jacchia et al. 2019) (EU-RL GMFF GMOMETHODS database as of January 15, 2020)

Comment:

Target is the cruciferin A (cruA) gene in oilseed rape (Brassica napus)

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Brassica napus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MDB510
  • Sequence:

    GGCCAGGGTTTCCGTGAT
  • Size:

    18
  • Reverse Primer

  • Name:

    MDB511
  • Sequence:

    CCGTCGTTGTAGAACCATTGG
  • Size:

    21
  • Probe

  • Name:

    TM458
  • Sequence:

    AGTCCTTATGTGCTCCACTTTCTGGTGCA
  • Size:

    29
  • Amplicon:

  • Sequence:

    ggccagggtttccgtgatntgcaccagaaagtggagcacataaggactnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccaatggttctacaacgacgg
  • Size:

    101

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-TAX-BN-003Link to the document url. EU reference method protocol 15-01-2020