Help icon

Detection Image Detection method details

Name:

QT-TAX-BN-001

Description:

Quantitative real-time PCR (TaqMan) method for detection of oilseed rape acyl-ACP thioesterase (FatA) gene (EU-RL GMFF GMOMETHODS database as of January 23, 2014)

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 1

Comment:

Target is the endogenous acyl-ACP thioesterase (FatA) gene from Brassica napus which is located on the A-genome in Brassica napus, B. rapa and B. juncea. The amplified FatA(A) fragment is 126 bp in a majority of B. napus varieties, in all B. juncea varieties and in some of the B. rapa varieties tested; it is of 129 bp in a minority of B. napus varieties and in some B. rapa varieties tested.

This assay is recommended for GMO quantitative analysis.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Brassica napus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    09-0-3249
  • Sequence:

    ACAGATGAAGTTCGGGACGAGTAC
  • Size:

    24
  • Reverse Primer

  • Name:

    09-0-3251
  • Sequence:

    CAGGTTGAGATCCACATGCTTAAATAT
  • Size:

    27
  • Probe

  • Name:

    09-QP-87
  • Sequence:

    AAGAAGAATCATCATGCTTC
  • Size:

    20
  • Amplicon:

  • Sequence:

    acagatgaagttcgggacgagtacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagaagaatcatcatgcttcnnnnnnnnnnnnnnnnnnnnnnnnnnatatttaagcatgtggatctcaacctg
  • Size:

    126

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-TAX-BN-001Link to the document url. EU reference method protocol
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018