Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-023

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event Bt176 (EU-RL GMFF GMOMETHODS database as of October 01, 2014)

Comment:

Target is the 3' integration border region (IBR) between the insert of maize event Bt176 and the maize host genome

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-014

Type:

event-specific

Target GMO name:

Bt176
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Bt176 F
  • Sequence:

    ggccgtgaacgagctgtt
  • Size:

    18
  • Reverse Primer

  • Name:

    Bt176 R
  • Sequence:

    gggaagaagcctacatgttttctaa
  • Size:

    25
  • Probe

  • Name:

    Bt176 Probe
  • Sequence:

    agcaaccagatcggccgacacc
  • Size:

    22
  • Amplicon:

  • Sequence:

    ggccgtgaacgagctgttnnnnnnnagcaaccagatcggccgacaccnnnnnnnnnnttagaaaacatgtaggcttcttccc
  • Size:

    82

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-023Link to the document url. EU reference method protocol