Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-003

Description:

Quantitative PCR method for detection of maize event MON87427 (EU-RL GMFF GMOMETHODS database as of April 21, 2017).

Comment:

Target is the 5' integration border region (IBR) between the insert of maize event MON87427 and the maize host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-002

Type:

event-specific

Target GMO name:

MON87427
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MON87427 primer1
  • Sequence:

    ACGGAAACGGTCGGGTCAAATG
  • Size:

    22
  • Reverse Primer

  • Name:

    MON87427 primer 2
  • Sequence:

    CCATGTAGATTTCCCGGTTTTCTC
  • Size:

    24
  • Probe

  • Name:

    MON87427 probe
  • Sequence:

    TCGGGACAATATGGAGAAAAAGAAAGAG
  • Size:

    28
  • Amplicon:

  • Sequence:

    acggaaacgg tcgggtcaaa tgnnnnnnnt cgggacaata tggagaaaaa gaaagagnnn nnnnnnnnnn ngagaaaacc gggaaatcta catgg
  • Size:

    95

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-003Link to the document url. EU reference method protocol 13-01-2020