Help icon

Detection Image Detection method details

Name:

QT-EVE-OS-001

Description:

Quantitative real-time PCR (TaqMan) method for detection of rice event Golden Rice 2 (EU-RL GMFF GMOMETHODS database as of April 19, 2016)

Comment:

Target is the 3' integration border region (IBR) between the insert of rice event Golden Rice 2 and the rice host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

event-specific

Target GMO name:

Golden Rice 2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    GR2 For
  • Sequence:

    TGGCCGTATCCGCAATGTG
  • Size:

    19
  • Reverse Primer

  • Name:

    RB-REV-BS
  • Sequence:

    GCTGCGCCTCTAACCAGGTAT
  • Size:

    21
  • Probe

  • Name:

    GR2 Probe
  • Sequence:

    TCGATATGATTCCTTCATCGAGCGAGC
  • Size:

    27
  • Amplicon:

  • Sequence:

    tggccgtatccgcaatgtgnnnnnnnnnnnnntcgatatgattccttcat cgagcgagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn atacctggttagaggcgcagc
  • Size:

    121

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-OS-001Link to the document url. EU reference method protocol 13-01-2020