Help icon

Detection Image Detection method details

Name:

QT-EVE-GM-015

Description:

Quantitative PCR method for detection of soybean event DAS44406 (EURL GMFF GMOMETHODS database as of May 28, 2015)

Comment:

Target is the 5' integration border region (IBR) between the insert of soybean event DAS44406 and the soybean host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GM-002

Type:

event-specific

Target GMO name:

DAS44406
  • Oligonucleotides:

  • Forward Primer

  • Name:

    DAS-44406-5F
  • Sequence:

    TTATTGTTCTTGTTGTTTCCTCTTTAGG
  • Size:

    28
  • Reverse Primer

  • Name:

    DAS-44406-5R
  • Sequence:

    CCTCAATTGCGAGCTTTCTAATTT
  • Size:

    24
  • Probe

  • Name:

    DAS-44406-6-5p1
  • Sequence:

    ATTCGGACCTCCATGATGACCTTACCGTT
  • Size:

    29
  • Amplicon:

  • Sequence:

    ttattgttcttgttgtttcctctttaggnnnnnnnnnnnnaacggtaaggtcatcatggaggtccgaatnnnnnnaaattagaaagctcgcaattgagg
  • Size:

    99

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-GM-015Link to the document url. EU reference method protocol 13-01-2020