Help icon

Detection Image Detection method details

Name:

QT-EVE-GM-013

Description:

Quantitative real-time PCR (TaqMan) method for the detection of soybean event DAS68416 (EU-RL GMFF GMOMETHODS database as of July 2, 2015)

Comment:

Target is the 3' integration border region (IBR) between the insert of soybean event DAS68416 and the soybean host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GM-002

Type:

event-specific

Target GMO name:

DAS68416
  • Oligonucleotides:

  • Forward Primer

  • Name:

    DAS-68416-4_3f5
  • Sequence:

    GTACATTAAAAACGTCCGCAATGTGT
  • Size:

    26
  • Reverse Primer

  • Name:

    DAS-68416-4_3r3
  • Sequence:

    GTTTAAGAATTAGTTCTTACAGTTTATTGTTAG
  • Size:

    33
  • Probe

  • Name:

    DAS-68416-4_3p3
  • Sequence:

    TTAAGTTGTCTAAGCGTCAATA
  • Size:

    22
  • Amplicon:

  • Sequence:

    gtacattaaaaacgtccgcaatgtgtnnttaagttgtctaagcgtcaatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctaacaataaactgtaagaactaattcttaaac
  • Size:

    130

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-GM-013Link to the document url. EU reference method protocol 13-01-2020