Help icon

Detection Image Detection method details

Name:

QT-EVE-GH-010

Description:

Quantitative PCR method for detection of cotton event MON88701 (EURL GMFF GMOMETHODS database as of April 21, 2017)

Comment:

Target is the 3' integration border region (IBR) between the insert of cotton event MON88701 and the cotton host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GH-015

Type:

event-specific

Target GMO name:

MON88701
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MON88701 primer 1
  • Sequence:

    CATACTCATTGCTGATCCATGTAGA
  • Size:

    25
  • Reverse Primer

  • Name:

    MON88701 primer 2
  • Sequence:

    AGTGTTAAACAAGTTATGTTCTAGAGC
  • Size:

    27
  • Probe

  • Name:

    MON88701 probe
  • Sequence:

    TTCCCGGACATGAAGCCTTAATTCAAT
  • Size:

    27
  • Amplicon:

  • Sequence:

    catactcatt gctgatccat gtaganttcc cggacatgaa gccttaattc aatnnnngct ctagaacata acttgtttaa cact
  • Size:

    84

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-GH-010Link to the document url. EU reference method protocol 10-01-2020