Help icon

Detection Image Detection method details

Name:

QT-EVE-GH-008

Description:

Quantitative real-time PCR (TaqMan) method for detection of cotton event GHB119 (EU-RL GMFF GMOMETHODS database as of July 21, 2014)

Comment:

Target is the 3' integration border region (IBR) between the insert of cotton event GHB119 and the cotton host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

event-specific

Target GMO name:

GHB119
  • Oligonucleotides:

  • Forward Primer

  • Name:

    SHA021
  • Sequence:

    ccagtactaaaatccagatcatgca
  • Size:

    25
  • Reverse Primer

  • Name:

    NEL109
  • Sequence:

    gaaattgcgtgactcaaattcc
  • Size:

    22
  • Probe

  • Name:

    TM082
  • Sequence:

    cctgcaggtcgacggccgagtac
  • Size:

    23
  • Amplicon:

  • Sequence:

    ccagtactaaaatccagatcatgcannnncctgcaggtcgacggccgagtacnnnnnnnnnnnnnnnnggaatttgagtcacgcaatttc
  • Size:

    90

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-GH-008Link to the document url. EU reference method protocol