Help icon

Detection Image Detection method details

Name:

QT-ELE-P35S 1-5'/P35S 1-3'

Description:

Quantitative real-time PCR (TaqMan) method for detection of the Cauliflower Mosaic Virus 35S promoter (Kodama et al., 2009)

Comment:

target is the 35S promoter (P-35S) sequence from the Cauliflower mosaic virus (CaMV)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

element-specific

Target DNA element:

P-Cauliflower mosaic virus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    P35S 1-5'
  • Sequence:

    ATTGATGTGATATCTCCACTGACGT
  • Size:

    25
  • Reverse Primer

  • Name:

    P35S 1-3'
  • Sequence:

    CCTCTCCAAATGAAATGAACTTCCT
  • Size:

    25
  • Probe

  • Name:

    P35S-Taq
  • Sequence:

    CCCACTATCCTTCGCAAGACCCTTCCT
  • Size:

    27
  • Amplicon:

  • Sequence:

    CCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAAT
  • Size:

    100

Documents

Citation Type Local copy
Hideo Kuribara, Yoichiro Shindo, Takeshi Matsuoka, Ken Takubo, Satoshi Futo, Nobutaro Aoki, Takashi Hirao, Hiroshi Akiyama, Yukihiro Goda, Masatake Toyada, Akihiro Hino. Novel reference molecules for quantitation of genetically modified maize and soybean.Link to the document url.