Help icon

Detection Image Detection method details

Name:

QT-ELE-00-003

Description:

Quantitative real-time PCR (TaqMan) method for detection of synthetic cryIA(b) gene (ISO/FDIS 21570)

Comment:

Target is the synthetic cryIA(b) gene

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry1Ab-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    CRY2-F
  • Sequence:

    CCCATCGACATCAGCCTGAGC
  • Size:

    21
  • Reverse Primer

  • Name:

    CRY2-R
  • Sequence:

    CAGGAAGGCGTCCCACTGGC
  • Size:

    20
  • Probe

  • Name:

    BTSYN
  • Sequence:

    ATGTCCACCAGGCCCAGCACG
  • Size:

    21
  • Amplicon:

  • Sequence:

    cccatcgacatcagcctgagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngccagtgggacgccttcctg
  • Size:

    129

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-ELE-00-003Link to the document url. EU reference method protocol
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document
Grisolia, C. K., Oliveira, R., Domingues, I., Oliveira-Filho, E. C., Monerat, R. G., & Soares, A. M. V. M. (2009). Genotoxic evaluation of different delta-endotoxins from Bacillus thuringiensis on zebrafish adults and development in early life stages. Mutation Research-Genetic Toxicology and Environmental Mutagenesis, 672(2), 119-123.Link to the document url. peer-reviewed article 05-04-2018