Help icon

Detection Image Detection method details

Name:

QT-CON-00-008

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event GA21 (Shindo et al., 2002)

Comment:

Target is the junction region between an optimized transit peptide sequence (OTP) and point mutated epsps gene (mEPSPS) from maize

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QT-TAX-ZM-006

Type:

construct-specific

Target GMO names:

GA21
  • Oligonucleotides:

  • Forward Primer

  • Name:

    GA21 3-5'
  • Sequence:

    GAAGCCTCGGCAACGTCA
  • Size:

    18
  • Reverse Primer

  • Name:

    GA21 3-3'
  • Sequence:

    ATCCGGTTGGAAAGCGACTT
  • Size:

    20
  • Probe

  • Name:

    GA21-2-Taq
  • Sequence:

    AAGGATCCGGTGCATGGCCG
  • Size:

    20
  • Amplicon:

  • Sequence:

    gaagcctcggcaacgtcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaagtcgctttccaaccggat
  • Size:

    133

Documents

Citation Type Local copy
Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., Akiyama H., Goda Y., Toyoda M., Hino A.; Validation of real-time PCR analyses for line-specific quantitation of genetically modified maize and soybean using new reference molecules J AOALink to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QT-CON-00-008Link to the document url. EU reference method protocol
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document