Help icon

Detection Image Detection method details

Name:

QT-CON-00-004

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event MON810 (Shindo et al., 2002)

Comment:

Target is the junction region between the Intron 1 from the maize hsp70 gene (IVS-HSP) and a synthetic cryIA(b) gene

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

construct-specific

Target GMO names:

MON80100, MON802, MON809, MON810
  • Oligonucleotides:

  • Forward Primer

  • Name:

    M810 2-5'
  • Sequence:

    GATGCCTTCTCCCTAGTGTTGA
  • Size:

    22
  • Reverse Primer

  • Name:

    M810 2-3'
  • Sequence:

    GGATGCACTCGTTGATGTTTG
  • Size:

    21
  • Probe

  • Name:

    M810-Taq
  • Sequence:

    AGATACCAAGCGGCCATGGACAACAA
  • Size:

    26
  • Amplicon:

  • Sequence:

    gatgccttctccctagtgttgannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaaacatcaacgagtgcatcc
  • Size:

    113

Documents

Citation Type Local copy
Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., Akiyama H., Goda Y., Toyoda M., Hino A.; Validation of real-time PCR analyses for line-specific quantitation of genetically modified maize and soybean using new reference molecules J AOALink to the document url. peer-reviewed article
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document
EU-RL GMFF GMOMETHODS database; QT-CON-00-004Link to the document url. EU reference method protocol