Help icon

Detection Image Detection method details

Name:

QT-CON-00-002

Description:

Quantitative real-time PCR (TaqMan) method for detection of soybean event GTS-40-3-2 (Hird et al., 2003).

Comment:

Target is the junction region between the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene and the CP4 epsps gene from Agrobacterium tumefaciens

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

QT-TAX-GM-004

Type:

construct-specific

Target GMO names:

GTS 40-3-2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    RR-F
  • Sequence:

    GGATTTCAGCATCAGTGGCTACA
  • Size:

    23
  • Reverse Primer

  • Name:

    RR-R
  • Sequence:

    CCGGAAAGGCCAGAGGAT
  • Size:

    18
  • Probe

  • Name:

    RR soya
  • Sequence:

    CCGGCTGCTTGCACCGTGAAG
  • Size:

    21
  • Amplicon:

  • Sequence:

    ggatttcagcatcagtggctacannnnnnnnncttcacggtgcaagcagccggnnnnnnnnnnnnnnnnnatcctctggcctttccgg
  • Size:

    88

Documents

Citation Type Local copy
Hird H., Powell J., Johnson M.L., Oehlschlager S.; Determination of percentage of RoundUp Ready soya in soya flour using real-time polymerase chain reaction: interlaboratory study J AOAC Int 86:66-71 (2003)Link to the document url. peer-reviewed article
PCR reactions set up and amplification conditions Online Publication (2010); QT-CON-00-002Link to the document url. EU reference method protocol 30-03-2012
EU-RL GMFF GMOMETHODS database; QT-CON-00-002Link to the document url. EU reference method protocol