Help icon

Detection Image Detection method details

Name:

QT-CON-00-001

Description:

Quantitative real-time PCR (TaqMan) method for detection of soybean event GTS-40-3-2 (ISO 21570)

Comment:

Target is the junction region between the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene and the CP4 epsps gene from Agrobacterium tumefaciens

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QT-TAX-GM-007

Type:

construct-specific

Target GMO names:

GTS 40-3-2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    RRS 01-5'
  • Sequence:

    CCTTTAGGATTTCAGCATCAGTGG
  • Size:

    24
  • Reverse Primer

  • Name:

    RRS 01-3'
  • Sequence:

    GACTTGTCGCCGGGAATG
  • Size:

    18
  • Probe

  • Name:

    RRS-Taq
  • Sequence:

    CGCAACCGCCCGCAAATCC
  • Size:

    19
  • Amplicon:

  • Sequence:

    cctttaggatttcagcatcagtggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncattcccggcgacaagtc
  • Size:

    121

Documents

Citation Type Local copy
Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., Akiyama H., Goda Y., Toyoda M., Hino A.; Validation of real-time PCR analyses for line-specific quantitation of genetically modified maize and soybean using new reference molecules J AOALink to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QT-CON-00-001Link to the document url. EU reference method protocol
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document