Help icon

Detection Image Detection method details

Name:

QL-TAX-ZM-003

Description:

Qualitative conventional PCR method for detection of the maize invertase gene (ISO 21569)

Comment:

Target is the endogenous invertase (Ivr1) gene from maize (Zea mays)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

taxon-specific

Target Species name:

Zea mays
  • Oligonucleotides:

  • Forward Primer

  • Name:

    IVR1-F
  • Sequence:

    ccgctgtatcacaagggctggtacc
  • Size:

    25
  • Reverse Primer

  • Name:

    IVR1-R
  • Sequence:

    ggagcccgtgtagagcatgacgatc
  • Size:

    25
  • Amplicon:

  • Sequence:

    ccgctgtatcacaagggctggtaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngatcgtcatgctctacacgggctcc
  • Size:

    225

Documents

Citation Type Local copy
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods ISO 21569:1-69 (2005)Link to the document url. other document
EU-RL GMFF GMOMETHODS database; QL-TAX-ZM-003Link to the document url. EU reference method protocol
Pan L., Zhang S., Yang L., Broll H., Tian F., Zhang D.; Interlaboratory trial validation of an event-specific qualitative polymerase chain reaction-based detection method for genetically modified RT73 rapeseed J AOAC Int 90:1639-1646 (2007)Link to the document url. peer-reviewed article