Help icon

Detection Image Detection method details

Name:

QL-TAX-DC-001

Description:

Qualitative conventional PCR method for detection of carnation anthocyanidin synthase (EURL GMFF GMOMETHODS database as of June 1, 2016).

Comment:

Target is the endogenous anthocyanidin synthase gene from Dianthus caryophyllus.

The amplicon sequence has been obtained by manual annotation (GenBank: AB727362.2) of Dianthus caryophyllus genomic DNA, anthocyanidin synthase promoter region.

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Dianthus caryophyllus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    ANS.F
  • Sequence:

    CTAGATCGGAGGTCACCATACC
  • Size:

    22
  • Reverse Primer

  • Name:

    ANS.R
  • Sequence:

    GAAACCGTGACCATGGTCTCG
  • Size:

    21
  • Amplicon:

  • Sequence:

    ctagatcggaggtcaccatacccgtgaagatttttctgtg agaggaaaagaacccaaggacgaggttcaaatctacacat ggaaagacgccacgcttcgtgagttaactgaccttgtatg tcgccatcgcttagcgtagcgctgaacatcgttttcaccc tgctccatccatcaaccatttattggtcttatacatgtgt gattgcgttgttcttacatttaggtgaaagacgtttctcc agctgctaggagtcgagatgcgaaattgtcgtttgcgact gtataccttgatagaaatggatgcatgcaagtaaagaagg tatcttctaattcatctttcgtagagacatagcgtgaatt tggacggggtctttggtttgagaaagataacagctttacg tatttttgtagatgggtgaaaccttttcaaatccgtataa gcgtaaagacgacaactgggctttaggggacacattcttt caggtataattgatgcgactaacaatagtctccactgatc atattctactcttctacgttcgatactgactgtttctggt tatttggtagacaggagattatttggacgtagcaattcag tagcgtagagatgtttccacacgtgttatcgtaaaagaag caagataagcctaatgcctagggtggtggtatgacttccg ttgcttatcgatcgtgcttgtaagtaatttccgtcttatc ttttcctgttatataaagttaatcttctctaggactttca tgaaccttgtttgtgtatttatttctcgatcaacatgata gagctagtttttaagcaacgtatactagtagtctattgga agttaagacacggttcttaaaaaggtacgatccaagtgaa gcatgttagatatgacactttcttctagggacgactctcg tatgccacccgactttttcaattttttttgtgaatgttag atgtgtgtatataatgcatccgaaagatgtctcaacgaac aaatgagccacctacttcgatcactcgctatcaatgttat taatgccttgttgattttaatagttgatcaataatagtaa aatctattcaagggtatagtctcccgttcacactcatcgg ggttacactagcgagctccattaatcggtgccttaatcga gacgctaagaactataccatgacctagtcagcgccatggg actgatgtaggccacacaatctcgatgatccgaaaacgct agagttcaagacctagttcgagaccatggtcacggtttc
  • Size:

    1279

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-TAX-DC-001Link to the document url. EU reference method protocol 16-01-2020