Help icon

Detection Image Detection method details

Name:

QL-TAX-CaMV-ORFV-fd2/CaMV-ORFV-rd2

Description:

Qualitative real-time PCR (TaqMan) method for detection of the open reading frame V (ORF V) from Cauliflower mosaic virus (CaMV)(BVL G30.40-17)

Comment:

Target is the open reading frame V (ORF V) from Cauliflower mosaic virus (CaMV)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

taxon-specific

Target Species name:

Cauliflower mosaic virus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    CaMV-ORFV-fd2
  • Sequence:

    atyaagcccagyaaaagccc
  • Size:

    20
  • Reverse Primer

  • Name:

    CaMV-ORFV-rd2
  • Sequence:

    ctycgcttctcggcttcrtt
  • Size:

    20
  • Probe

  • Name:

    CaMV-ORFV-P2
  • Sequence:

    catggcaccagccttcttggtcaac
  • Size:

    25
  • Amplicon:

  • Sequence:

    atcaagcccagtaaaagccctcacatggcaccagccttcttggtcaacaatgaagccgagaagcgaag
  • Size:

    68

Documents

Citation Type Local copy