Help icon

Detection Image Detection method details

Name:

QL-EVE-MS-KK179-F/KK179-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of alfalfa event KK179 (Guertler et al. 2018)

Comment:

Target is the 5' integration border region (IBR) between the insert of alfalfa event KK179 and the alfalfa host genome

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

QL-TAX-Acc1-F/Acc1-R

Type:

event-specific

Target GMO name:

KK179
  • Oligonucleotides:

  • Forward Primer

  • Name:

    KK179-F
  • Sequence:

    CTTAgggCACTTgTTAgCATTTTC
  • Size:

    24
  • Reverse Primer

  • Name:

    KK179-R
  • Sequence:

    CCATATTgACCATCATACTCATTgC
  • Size:

    25
  • Probe

  • Name:

    KK179-P
  • Sequence:

    TggCTTCATgTCCgggAAATCTACATgg
  • Size:

    28
  • Amplicon:

  • Sequence:

    CTTAGGGCACTTGTTAGCATTTTCCTAAAAATAATAGATACAGTTGAAATCGTATTTGAAATTAATTAAGTAGATATTTAAATCGAATCAAACCACAATTGATAATAATCTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGG
  • Size:

    179

Documents

Citation Type Local copy
Guertler et al., Development of event-specific qPCR detection methods for genetically modified alfalfa events J101, J163 and KK179. Biomolecular Detection and Quantification 2019, 17, 100076.Link to the document url. peer-reviewed article 29-04-2019