Help icon

Detection Image Detection method details

Name:

QL-EVE-MDB110/SHA016

Description:

Qualitative real-time PCR (TaqMan) method for detection of of oilseed rape event OXY-235 (EURL GMFF, 2016))

Comment:

Target is the 3' integration border region (IBR) between the insert of Brassica napus event OXY-235 and the Brassica napus host genome

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-BN-012

Type:

event-specific

Target GMO name:

OXY-235
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MDB110
  • Sequence:

    CGAATTTGGCCTGTAGACCTCAATTGCGAGC
  • Size:

    31
  • Reverse Primer

  • Name:

    SHA016
  • Sequence:

    CGCCGTGCTTCATAACCG
  • Size:

    18
  • Probe

  • Name:

    TM033
  • Sequence:

    CAGCATCATCACACCAAAAGTTAGGCC
  • Size:

    27
  • Amplicon:

  • Sequence:

    CGAATTTGGCCTGTAGACCTCAATTGCGAGCTTTCTAATTTCAAACTATTCGGGCCTAACTTTTGGTGTGATGATGCTGACTGGCAAGTTAATCTAGTTTCCGGTTATGAAGCACGGCG
  • Size:

    119

Documents

Citation Type Local copy
Event-Specific Method for the Detection of Oilseed Rape Oxy-235 Using Real-Time PCR. EURL-GMFF Validation Report (2016)Link to the document url. other document 24-05-2016