Help icon

Detection Image Detection method details

Name:

QL-EVE-DC-006

Description:

Qualitative conventional PCR method for detection of carnation event 123.8.8 (EURL GMFF GMOMETHODS database as of December 15, 2017).

Comment:

Target is the 3' integration border region (IBR) between the insert of carnation event 123.8.8 and the carnation host genome.

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

Type:

event-specific

Target GMO name:

123.8.8
  • Oligonucleotides:

  • Forward Primer

  • Name:

    RBF1a
  • Sequence:

    TGGTGGACCCTTGAGGAAACTG
  • Size:

    22
  • Reverse Primer

  • Name:

    123.8.8-2.1R
  • Sequence:

    ATACAATGGCTGACTGATGTAG
  • Size:

    20
  • Probe

  • Name:

  • Sequence:

  • Size:

  • Amplicon:

  • Sequence:

    tggtggacccttgaggaaactgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctacatcagtcagccattgtat
  • Size:

    338

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-EVE-DC-006Link to the document url. EU reference method protocol 13-01-2020