Help icon

Detection Image Detection method details

Name:

QL-EVE-DC-005

Description:

Qualitative PCR method for detection of carnation event 27531 (verified by the EURL GMFF in the context of Commission Implementing Decision (EU) 2016/2050) (EURL GMFF GMOMETHODS database as of December 1, 2016)

Comment:

Target is the 5' integration border region (IBR) between the insert of carnation event 27531 and the carnation host genome.

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

QL-TAX-DC-001

Type:

event-specific

Target GMO name:

27531
  • Oligonucleotides:

  • Forward Primer

  • Name:

    7531 LB Specific fw
  • Sequence:

    CGAGTAAATTCAAGCATGCCC
  • Size:

    21
  • Reverse Primer

  • Name:

    carLB-reverse
  • Sequence:

    CCATATTGACCATCATACTCATTGC
  • Size:

    25
  • Amplicon:

  • Sequence:

    cgagtaaattcaagcatgcccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngcaatgagtatgatggtcaatatgg
  • Size:

    458

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-EVE-DC-005Link to the document url. EU reference method protocol 13-01-2020