Help icon

Detection Image Detection method details

Name:

QL-EVE-DC-001

Description:

Qualitative conventional PCR method for the detection of carnation event 123.2.38 (FLO-40644-6, previously known as FLO-40644-4) (verified by the CRL GMFF in the context of Commission Decision 2007/364/EC)(EURL GMFF GMOMETHODS database as of May 18, 2016).

Comment:

Target is the 5' integration border region (IBR) between the insert of carnation event 123.2.38 and the carnation host genome.

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

QL-TAX-DC-001

Type:

event-specific

Target GMO name:

123.2.38
  • Oligonucleotides:

  • Forward Primer

  • Name:

    LB123.2.38-R
  • Sequence:

    CAATGCCTCGCCTTTTGTGG
  • Size:

    20
  • Reverse Primer

  • Name:

    LB inside.R
  • Sequence:

    ACGTGAATGTAGACACGTCG
  • Size:

    20
  • Probe

  • Name:

  • Sequence:

  • Size:

  • Amplicon:

  • Sequence:

    caatgcctcgccttttgtggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgacgtgtctacattcacgt
  • Size:

    375

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-EVE-DC-001Link to the document url. EU reference method protocol 13-01-2020