Help icon

Detection Image Detection method details

Name:

QL-EVE-558F/558R

Description:

Qualitative real-time PCR (TaqMan) method for detection of Bacillus subtilis isolate e871 (Paracchini et al., 2017)

Comment:

Target is the integration site between the inserted cat gene and the endogenous recA gene of Bacillus subtilis

Validation:

unknown

Standardisation:

none

Related Methods:

Type:

event-specific

Target GMO name:

e871 Bacillus subtilis
  • Oligonucleotides:

  • Forward Primer

  • Name:

    558-F
  • Sequence:

    cgagcttttgcgcgtata
  • Size:

    18
  • Reverse Primer

  • Name:

    558-R
  • Sequence:

    gccattccaatacaaaaccacata
  • Size:

    24
  • Probe

  • Name:

    558-Tm
  • Sequence:

    cggatctaacgcatgctccgca
  • Size:

    22
  • Amplicon:

  • Sequence:

    cgagcttttgcgcgtataccggatctaacgcatgctccgcatcgattataggtatgtggttttgtattggaatggc
  • Size:

    76

Documents

Citation Type Local copy