Help icon

Detection Image Detection method details

Name:

QL-ELE-PFMV 1-5'/PFMV 1-3'

Description:

Qualitative real-time PCR (TaqMan) method for detection of P-FMV (Mano et al., 2009)

Comment:

Target is the 34S promoter sequence (P-FMV) from Figwort mosaic virus

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

P-FMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    PFMV 1-5'
  • Sequence:

    ATCAACAAGGTACGAGCCATATC
  • Size:

    23
  • Reverse Primer

  • Name:

    PFMV 1-3'
  • Sequence:

    TGAGGCTTTGGACTGAGAATTC
  • Size:

    22
  • Probe

  • Name:

    PFMV-1-Taq
  • Sequence:

    CCAAGAAGGAACTCCCATCCTCAAAGGTTT
  • Size:

    30
  • Amplicon:

  • Sequence:

    ATCAACAAGGTACGAGCCATATCACTTTATTCAAATTGGTATCGCCAAAACCAAGAAGGAACTCCCATCCTCAAAGGTTTGTAAGGAAGAATTCTCAGTCCAAAGCCTCA
  • Size:

    110

Documents

Citation Type Local copy
Mano J, Shigemitsu N, Futo S, Akiyama H, Teshima R, Hino A, Furui S, Kitta K (2009) Real-Time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan, Journal of Agricultural and Food Chemistry, 57, 26-37Link to the document url. peer-reviewed article