Help icon

Detection Image Detection method details

Name:

QL-ELE-Cry3Bbf-n2/Cry3Bbr-n2

Description:

Qualitative real-time PCR (TaqMan) method for detection of cry3Bb gene (Scholtens et al., 2013; GMDD)

Comment:

target is the cry3Bb gene from bacterium Bacillus thuringiensis subsp. kumamotoensis

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry3Bb1-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Cry3Bbf-n2
  • Sequence:

    ccgcccaggactccatcg
  • Size:

    18
  • Reverse Primer

  • Name:

    Cry3Bbr-n2
  • Sequence:

    gaggcacccgaggacagg
  • Size:

    18
  • Probe

  • Name:

    Cry3BbP-n3
  • Sequence:

    ctgccgcctgagaccactgacgagc
  • Size:

    25
  • Amplicon:

  • Sequence:

    ccgcccaggactccatcgaccagctgccgcctgagaccactgacgagcccctggagaaggcctactcccaccagctgaactacgcggagtgcttcctgatgcaagaccgcaggggcaccatccccttcttcacctggacccaccgctccgtcgacttcttcaacaccatcgacgccgagaagatcacccagctgcccgtggtcaaggcctacgccctgtcctcgggtgcctc
  • Size:

    232

Documents

Citation Type Local copy
Scholtens et al. (2012)