Help icon

Detection Image Detection method details

Name:

QL-ELE-00-016

Description:

Qualitative real-time PCR (TaqMan) method for detection of the element coding for synthetic cry1Ab/Ac genes (ISO/TS 21569-6)

Comment:

Targets are synthetic cry1Ab, cry1Ac or cry1Ab/Ac fusion genes derived from Bacillus thuringiensis

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry1Ab_Ac-SYNTH, CS-cry1Ac-BACTU, CS-cry1Ab-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Bt-F1(mod)
  • Sequence:

    gaggaaatgcgtattcaattcaac
  • Size:

    24
  • Reverse Primer

  • Name:

    Bt-R
  • Sequence:

    ttctggactgcgaacaatgg
  • Size:

    20
  • Probe

  • Name:

    Bt-P
  • Sequence:

    acatgaacagcgccttgaccacagc
  • Size:

    25
  • Amplicon:

  • Sequence:

    gaggaaatgcgtattcaattcaacgacatgaacagcgccttgaccacagctatcccattgttcgcagtccagaa
  • Size:

    74

Documents

Citation Type Local copy
Xu, W., Cao, S., He, X., Luo, Y., Guo, X., Yuan, Y., Huang, K. (2009). Safety assessment of Cry1Ab/Ac fusion protein. Food and Chemical Toxicology, 47(7), 1459-1465.Link to the document url. peer-reviewed article 23-03-2018
EU-RL GMFF GMOMETHODS database; QL-ELE-00-016Link to the document url. EU reference method protocol
Grisolia, C. K., Oliveira, R., Domingues, I., Oliveira-Filho, E. C., Monerat, R. G., & Soares, A. M. V. M. (2009). Genotoxic evaluation of different delta-endotoxins from Bacillus thuringiensis on zebrafish adults and development in early life stages. Mutation Research-Genetic Toxicology and Environmental Mutagenesis, 672(2), 119-123.Link to the document url. peer-reviewed article 05-04-2018