Help icon

Detection Image Detection method details

Name:

QL-TAX-LU-001

Description:

Qualitative real-time PCR (TaqMan) method for detection flax stearoyl-acyl carrier protein desaturase gene of flax/linseed (EU-RL GMFF GMOMETHODS database as of January 16, 2020)

Comment:

Target is the endogenous stearoyl-acyl carrier protein desaturase gene (sad) of Linum usitatissimum

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

taxon-specific

Target Species name:

Linum usitatissimum
  • Oligonucleotides:

  • Forward Primer

  • Name:

    SAD-FW
  • Sequence:

    GCTCAACCCAGTCACCACCT
  • Size:

    20
  • Reverse Primer

  • Name:

    SAD-RV
  • Sequence:

    TGCGAGGAGATCTGGAGGAG
  • Size:

    20
  • Probe

  • Name:

    SAD-probe
  • Sequence:

    TGTTGAGGGAGCGTGTTGAAGGGA
  • Size:

    24
  • Amplicon:

  • Sequence:

    gctcaaccca gtcaccacct tcccttcaac acgctccctc aacannnnct cctccagatc tcctcgca
  • Size:

    68

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-TAX-LU-001Link to the document url. EU reference method protocol 16-01-2020