Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-014

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event GA21 (EU-RL GMFF GMOMETHODS database as of October 01, 2014)

Comment:

Target is the 5' integration border region (IBR) between the insert of maize event GA21 and the maize host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-014

Type:

event-specific

Target GMO name:

GA21
  • Oligonucleotides:

  • Forward Primer

  • Name:

    esGA21-5' forward primer
  • Sequence:

    CGTTATGCTATTTGCAACTTTAGAACA
  • Size:

    27
  • Reverse Primer

  • Name:

    esGA21-5' reverse primer
  • Sequence:

    GCGATCCTCCTCGCGTT
  • Size:

    17
  • Probe

  • Name:

    esGA21-5' probe
  • Sequence:

    TTTCTCAACAGCAGGTGGGTCCGGGT
  • Size:

    26
  • Amplicon:

  • Sequence:

    cgttatgctatttgcaactttagaacannnnnnnnnnnnnnnnnntttctcaacagcaggtgggtccgggtnnnnnnnnnnnnnaacgcgaggaggatcgc
  • Size:

    101

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-014Link to the document url. application dossier