Help icon

Detection Image Detection method details

Name:

QL-EVE-MS-J101-F/J101-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of alfalfa event J101 (Guertler et al. 2018)

Comment:

Target is the 5' integration border region (IBR) between the insert of alfalfa event J101 and the alfalfa host genome

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

QL-TAX-Acc1-F/Acc1-R

Type:

event-specific

Target GMO name:

J101
  • Oligonucleotides:

  • Forward Primer

  • Name:

    J101-F
  • Sequence:

    gTCATgTgTTTTgTACTgATCTTgTg
  • Size:

    26
  • Reverse Primer

  • Name:

    J101-R
  • Sequence:

    gACCTgCAgAAgCTTgATgg
  • Size:

    20
  • Probe

  • Name:

    J101-P
  • Sequence:

    ACTgAAggCgggAAACgACAATCTgATCC
  • Size:

    29
  • Amplicon:

  • Sequence:

    GTCATGTGTTTTGTACTGATCTTGTGTCATAGTTTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCCCCATCAAGCTTCTGCAGGTC
  • Size:

    102

Documents

Citation Type Local copy
Guertler et al., Development of event-specific qPCR detection methods for genetically modified alfalfa events J101, J163 and KK179. Biomolecular Detection and Quantification 2019, 17, 100076.Link to the document url. peer-reviewed article 29-04-2019