Help icon

Detection Image Detection method details

Name:

QL-EVE-DC-003

Description:

Qualitative conventional PCR method for the detection of carnation event 25958 (verified by the EURL GMFF in the context of Commission Implementing Decision (EU) 2015/692) (EURL GMFF GMOMETHODS database as of June 1, 2016)

Comment:

Target is the 3' integration border region (IBR) between the insert of carnation event 25958 and the carnation host genome.

Validation:

in-house validation

Standardisation:

EU reference method

Related Methods:

QL-TAX-DC-001

Type:

event-specific

Target GMO name:

25958
  • Oligonucleotides:

  • Forward Primer

  • Name:

    RB Forward
  • Sequence:

    TGGACCCTTGAGGAAACTGGTAGC
  • Size:

    24
  • Reverse Primer

  • Name:

    IFD-25958-3 Reverse
  • Sequence:

    CTTGTACACCGCGTTATGCTC
  • Size:

    21
  • Amplicon:

  • Sequence:

    tggacccttgaggaaactggtagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagcataacgcggtgtacaag
  • Size:

    482

Documents

Citation Type Local copy