Help icon

Detection Image Detection method details

Name:

QL-ELE-epsps 1-5'/epsps 3-3'

Description:

Qualitative real-time PCR (TaqMan) method for detection of the CP4-epsps gene (Scholtens et al. 2013)

Comment:

target is the CP4-epsps gene from bacterium Agrobacterium tumefaciens

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-CP4epsps-RHIRD
  • Oligonucleotides:

  • Forward Primer

  • Name:

    epsps 1-5'
  • Sequence:

    gcctcgtgtcggaaaaccct
  • Size:

    20
  • Reverse Primer

  • Name:

    epsps 3-3'
  • Sequence:

    ttcgtatcggagagttcgatcttc
  • Size:

    24
  • Probe

  • Name:

    epsps-probe
  • Sequence:

    tgccacgatgatcgccacgagcttcc
  • Size:

    26
  • Amplicon:

  • Sequence:

    gcctcgtgtcggaaaaccctgtcacggtggacgatgccacgatgatcgccacgagcttcccggagttcatggacctgatggccgggctgggcgcgaagatcgaactctccgatacgaa
  • Size:

    118

Documents

Citation Type Local copy
Mano J, Shigemitsu N, Futo S, Akiyama H, Teshima R, Hino A, Furui S, Kitta K (2009) Real-Time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan, Journal of Agricultural and Food Chemistry, 57, 26-37Link to the document url. peer-reviewed article