Help icon

Detection Image Detection method details

Name:

QL-ELE-cry2Ab2 - F/cry2Ab2 - R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the cry2Ab2 gene (Dinon et al. 2011)

Comment:

target is the cry2Ab2 gene from bacterium Bacillus thuringiensis var. kumamotoensis

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry2Ab2-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cry2Ab2 - F
  • Sequence:

    aattctaactacttccccgactacttc
  • Size:

    27
  • Reverse Primer

  • Name:

    cry2Ab2 - R
  • Sequence:

    acggagaggcgatgttcctg
  • Size:

    20
  • Probe

  • Name:

    cry2Ab2 - P
  • Sequence:

    tctctggtgttcctctcgtcgtccgca
  • Size:

    27
  • Amplicon:

  • Sequence:

    aattctaactacttccccgactacttcatcaggaacatctctggtgttcctctcgtcgtccgcaacgaggacctccgccgtccactgcactacaacgagatcaggaacatcgcctctccgt
  • Size:

    121

Documents

Citation Type Local copy
Dinon, A. Z., T. W. Prins, et al. (2011). Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms." Analytical and Bioanalytical Chemistry 400(5): 1433-1442.Link to the document url.