Help icon

Detection Image Detection method details

Name:

QL-ELE-cry1A 4-5'/cry1A 4-3'

Description:

Qualitative real-time PCR (TaqMan) method for detection of the cry1Ab gene (Scholtens et al. 2013)

Comment:

target is the cry1Ab gene from bacterium Bacillus thuringiensis subsp. kurstaki (Btk))

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry1Ab-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cry1A 4-5'
  • Sequence:

    ggacaacaacccmaacatcaac
  • Size:

    22
  • Reverse Primer

  • Name:

    cry1A 4-3'
  • Sequence:

    gcacgaactcgctsagcag
  • Size:

    19
  • Probe

  • Name:

    Cry1A(b)-probe
  • Sequence:

    catcccgtacaactgcctcagcaaccctg
  • Size:

    29
  • Amplicon:

  • Sequence:

    ggacaacaacccaaacatcaacgagtgcatcccgtacaactgcctcagcaaccctgaggtcgaggtgctcggcggtgagcgcatcgagaccggttacacccccatcgacatctccctctccctcacgcagttcctgctcagcgagttcgtgc
  • Size:

    152

Documents

Citation Type Local copy
Matsuoka T, Kuribara H, Takubo K, Akiyama H, Miura H, Goda Y, Kusakabe Y, Isshiki K, Toyoda M, Hino A (2002) Detection of recombinant DNA segments introduced to genetically modified maize (*Zea mays*). J Agric Food Chem 50, 2100-2109Link to the document url.
Grisolia, C. K., Oliveira, R., Domingues, I., Oliveira-Filho, E. C., Monerat, R. G., & Soares, A. M. V. M. (2009). Genotoxic evaluation of different delta-endotoxins from Bacillus thuringiensis on zebrafish adults and development in early life stages. Mutation Research-Genetic Toxicology and Environmental Mutagenesis, 672(2), 119-123.Link to the document url. peer-reviewed article 05-04-2018