Help icon

Detection Image Detection method details

Name:

QL-ELE-Vip3A-F/Vip3A-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the vip3A gene (Liang et al., 2013)

Comment:

target is the vip3A gene from bacterium Bacillus thuringiensis strain AB88

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-vip3Aa20-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Vip3A-F
  • Sequence:

    tcaccaagaagatgaagac
  • Size:

    19
  • Reverse Primer

  • Name:

    Vip3A-R
  • Sequence:

    ctctccaccttcttcttg
  • Size:

    18
  • Probe

  • Name:

    Vip3A-P
  • Sequence:

    gaccgccaacttctacgaca
  • Size:

    20
  • Amplicon:

  • Sequence:

    -
  • Size:

    97

Documents

Citation Type Local copy
Liang et al., 2012