Help icon

Detection Image Detection method details

Name:

QL-ELE-At-nop-f2/At-nop-r2

Description:

Qualitative real-time PCR (TaqMan) method for detection of the nopaline synthase gene (nos) from Agrobacterium tumefaciens (BVL G30.40-16)

Comment:

Target is the nopaline synthase gene (nos) from Agrobacterium tumefaciens (indicating the presence of Ti-plasmid from phytopathogenic Agrobacterium strains)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

element-specific

Target DNA element:

CS-nos-RHIRD
  • Oligonucleotides:

  • Forward Primer

  • Name:

    At-nop-f2
  • Sequence:

    ccagccrtstactgattattgtmac
  • Size:

    25
  • Reverse Primer

  • Name:

    At-nop-r2
  • Sequence:

    tgcgagttcrccgttgaag
  • Size:

    19
  • Probe

  • Name:

    At-nop-s1
  • Sequence:

    ccgtgcggacgttcacgacag
  • Size:

    21
  • Amplicon:

  • Sequence:

    ccagccgtgtactgattattgtaacccgtgcggacgttcacgacagcttcgtcaacgaactcgccaacttcaacggcgaactcgca
  • Size:

    86

Documents

Citation Type Local copy