Help icon

Detection Image Detection method details

Name:

QL-ELE-AINT 2-5'/AINT 2-3'

Description:

Qualitative real-time PCR (TaqMan) method for detection of rice actin 1 intron (I-ractI) (Mano et al. 2009).

Comment:

target is the actin 1 intron from rice (Oryza sativa)

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

I-actin
  • Oligonucleotides:

  • Forward Primer

  • Name:

    AINT 2-5'
  • Sequence:

    tcgtcaggcttagatgtgctaga
  • Size:

    23
  • Reverse Primer

  • Name:

    AINT 2-3'
  • Sequence:

    ctgcatttgtcacaaatcatgaa
  • Size:

    23
  • Probe

  • Name:

    AINT-2-Taq
  • Sequence:

    tttgtgggtagaatttgaatccctcagc
  • Size:

    28
  • Amplicon:

  • Sequence:

    tcgtcaggcttagatgtgctagatctttctttcttctttttgtgggtagaatttgaatccctcagcattgttcatcggtagtttttcttttcatgatttgtgacaaatgcag
  • Size:

    112

Documents

Citation Type Local copy
Mano J, Shigemitsu N, Futo S, Akiyama H, Teshima R, Hino A, Furui S, Kitta K (2009) Real-Time PCR array as a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan, Journal of Agricultural and Food Chemistry, 57, 26-37Link to the document url. peer-reviewed article