Help icon

Detection Image Detection method details

Name:

QL-ELE-00-025

Description:

Qualitative real-time PCR (TaqMan) method for detection of the synthetic phosphinothricin acetyltransferase (pat) gene (BVL L00.00-154). EU-RL GMFF GMOMETHODS database as of December 23, 2016.

Comment:

Target is the synthetic phosphinothricin acetyltransferase (pat) gene from bacterium Streptomyces viridochromogenes.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

element-specific

Target DNA element:

CS-pat-STRVR
  • Oligonucleotides:

  • Forward Primer

  • Name:

    pat-F
  • Sequence:

    cgcggtttgtgatatcgttaac
  • Size:

    22
  • Reverse Primer

  • Name:

    pat-R
  • Sequence:

    tcttgcaacctctctagatcatcaa
  • Size:

    25
  • Probe

  • Name:

    pat-P
  • Sequence:

    aggacagagccacaaacaccacaagagtg
  • Size:

    29
  • Amplicon:

  • Sequence:

    cgcggtttgtgatatcgttaaccattacattgagacgtctacagtgaactttaggacagagccacaaacaccacaagagtggattgatgatctagagaggttgcaaga
  • Size:

    108

Documents

Citation Type Local copy
Huber, I. et al. (2013). Development and Validation of Duplex, Triplex, and Pentaplex Real-Time PCR Screening Assays for the Detection of Genetically Modified Organisms in Food and Feed. J. Agric. Food Chem. 61, 10293–10301Link to the document url. peer-reviewed article 03-05-2016