Help icon

Detection Image Detection method details

Name:

QL-ELE-00-006

Description:

Qualitative conventional PCR method for detection of nopaline synthase terminator (Official Collection of Methods according to § 64 LFGB, L 00.00-31)

Comment:

Target is the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

element-specific

Target DNA element:

T-nos-RHIRD
  • Oligonucleotides:

  • Forward Primer

  • Name:

    NOS-1
  • Sequence:

    GAATCCTGTTGCCGGTCTTG
  • Size:

    20
  • Reverse Primer

  • Name:

    NOS-1
  • Sequence:

    TTATCCTAGTTTGCGCGCTA
  • Size:

    20
  • Amplicon:

  • Sequence:

    gaatcctgttgccggtcttgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntagcgcgcaaactaggataa
  • Size:

    180

Documents

Citation Type Local copy
Screening procedure for the detection of genetically modified DNA sequences in foods by identification of DNA sequences that frequently occur in genetically modified organisms. BVL Official Method Collection L 00.00-31 Online Publication (2001)Link to the document url. other document 11-05-2016
EU-RL GMFF GMOMETHODS database; QL-ELE-00-006Link to the document url. EU reference method protocol
Lipp M., Brodmann P., Pietsch K., Pauwels J., Anklam E., Borchers T., Braunschweiger G., Busch U., Eklund E., Eriksen F.D., Fagan J., Fellinger A., Gaugitsch H., Hayes D., Hertel C., Hortner H., Joudrier P., Kruse L., Meyer R., Miraglia M., Muller W., PhiLink to the document url. peer-reviewed article