Help icon

Detection Image Detection method details

Name:

QL-ELE-00-005

Description:

Qualitative conventional PCR method for detection of Cauliflower Mosaic Virus 35S promoter (ISO/FDIS 21569)

Comment:

Target is the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

P-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-1
  • Sequence:

    GCTCCTACAAATGCCATCA
  • Size:

    19
  • Reverse Primer

  • Name:

    35S-2
  • Sequence:

    GATAGTGGGATTGTGCGTCA
  • Size:

    20
  • Amplicon:

  • Sequence:

    gctcctacaaatgccatcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntgacgcacaatcccactatc
  • Size:

    195

Documents

Citation Type Local copy
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods ISO 21569:1-69 (2005)Link to the document url. other document
EU-RL GMFF GMOMETHODS database; QL-ELE-00-005Link to the document url. EU reference method protocol