Help icon

Detection Image Detection method details

Name:

QL-ELE-00-001

Description:

Qualitative conventional PCR method for detection of Cauliflower Mosaic Virus 35S promoter (Official Collection of Methods according to § 64 LFGB, L 00.00-31)

Comment:

Target is the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

element-specific

Target DNA element:

P-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-1
  • Sequence:

    GCTCCTACAAATGCCATCA
  • Size:

    19
  • Reverse Primer

  • Name:

    35S-2
  • Sequence:

    GATAGTGGGATTGTGCGTCA
  • Size:

    20
  • Amplicon:

  • Sequence:

    -
  • Size:

    195

Documents

Citation Type Local copy
Screening procedure for the detection of genetically modified DNA sequences in foods by identification of DNA sequences that frequently occur in genetically modified organisms. BVL Official Method Collection L 00.00-31 Online Publication (2001)Link to the document url. other document 11-05-2016
Lipp M., Brodmann P., Pietsch K., Pauwels J., Anklam E., Borchers T., Braunschweiger G., Busch U., Eklund E., Eriksen F.D., Fagan J., Fellinger A., Gaugitsch H., Hayes D., Hertel C., Hortner H., Joudrier P., Kruse L., Meyer R., Miraglia M., Muller W., PhiLink to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QL-ELE-00-001Link to the document url. EU reference method protocol