Help icon

Detection Image Detection method details

Name:

QL-CON-35S-5' primer A/A1-3' primer B

Description:

Qualitative conventional PCR method for detection of junction between the 35S promoter (P-35S CaMV) and the maize A1 gene (dihydroflavonol-4-reductase) of Zea mays (Meyer et al., 1993)

Comment:

Target is the junction region between the Cauliflower mosaic virus (CaMV) 35S promoter (P-35S) and the dihydroflavonol-4-reductase (dfr) gene of Zea mays

Validation:

unknown

Standardisation:

none

Related Methods:

Type:

construct-specific

Target GMO names:

RL01-15, RL01-17, dfr GM petunia
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-5' primer A
  • Sequence:

    CCTCCTCGGATTCCATTGCCCAGC
  • Size:

    24
  • Reverse Primer

  • Name:

    A1-3' primer B
  • Sequence:

    CCTCCATTATCGCCTCCCGCG
  • Size:

    21
  • Amplicon:

  • Sequence:

    cctcctcggattccattgcccagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgcgggaggcgataatggagg
  • Size:

    414

Documents

Citation Type Local copy
Meyer P, Heidmann I, Niedenhof I (1993) Differences in DNA-methylation are associated with a paramutation phenomenon in transgenic petunia. Plant J. 4:89-100Link to the document url. peer-reviewed article 04-05-2017