Help icon

Detection Image Detection method details

Name:

QL-CON-307-F/652-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the junction between the CaMV 35S promoter and the hpt gene (Reiting et al., 2013)

Comment:

Target is the junction region between the Cauliflower mosaic virus (CaMV) 35S promoter (P-35S) and the hygromycin phophotransferase II (hpt) gene

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

construct-specific

Target GMO names:

KMD1, Kefeng6
  • Oligonucleotides:

  • Forward Primer

  • Name:

    307-F
  • Sequence:

    gacgtaagggatgacgcacaa
  • Size:

    21
  • Reverse Primer

  • Name:

    652-R
  • Sequence:

    tgagttcaggctttttcatatctcat
  • Size:

    26
  • Probe

  • Name:

    307-T
  • Sequence:

    cctctccaaatgaaatgaacttcct
  • Size:

    25
  • Amplicon:

  • Sequence:

    gacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcatttggagaggacacgctgaaatcaccagtctctctctacaaatctatctctctcgagctttcgcagatccggggggcaatgagatatgaaaaagcctgaactca
  • Size:

    175

Documents

Citation Type Local copy
Reiting R, Grohmann L, Moris G, Maede D (2013) Detection and characterization of an unknown rice event in Basmati rice products. Eur. Food Res. Technol. 236:715-723Link to the document url. peer-reviewed article 04-05-2016